What Is Gene

Molecule Tutorials - Herong's Tutorial Examples

∟What Is Gene

This section provides a quick introduction of gene, which is a section of a double helix DNA structure that contains a specific sequence of base pairs representing a specific coded instruction to construct building blocks for living organisms.

What Is Gene? - A Gene is a section of a double helix DNA structure that contains a specific sequence of base pairs representing a specific coded instruction to construct building blocks for living organisms.

We have identified about 25,000 genes. 20,687 of them contain coded instructions to construct proteins. The latest study show that human has about 19,000 genes.

The average size of a gene is 10–15 kb (kilo base-pairs). A small gene has about 0.2 bk (or 200 base pairs). A large gene has about 2,500 kb.

An example of a small gene is the SPRR4 (Small Proline Rich Protein 4) gene, which contains coded instructions to construct the SPRR4 protein. SPRR4 gene has 240 base pairs. If we separate the two DNA strands of this second of the double DNA helix structure, one strand is named as "sense strand" and the other as "antisense strand". The Nucleotide Sequence of the sense strand of the SPRR4 gene can be expressed as below using the 1-letter abbreviation of each Nucleotide:

ATGTCTTCCCAGCAGCAGCAGCGGCAGCAGCAGCAGTGCCCACCCCAGAGGGCCCAGCAGCAGCAAGTGA
AGCAGCCTTGTCAGCCACCCCCTGTTAAATGTCAAGAGACATGTGCACCCAAAACCAAGGATCCATGTGC
TCCCCAGGTCAAGAAGCAATGCCCACCGAAAGGCACCATCATTCCAGCCCAGCAGAAGTGTCCCTCAGCC
CAGCAAGCCTCCAAGAGCAAACAGAAGTAA