What Is Gene

This section provides a quick introduction of gene, which is a section of a double helix DNA structure that contains a specific sequence of base pairs representing a specific coded instruction to construct building blocks for living organisms.

What Is Gene? - A Gene is a section of a double helix DNA structure that contains a specific sequence of base pairs representing a specific coded instruction to construct building blocks for living organisms.

We have identified about 25,000 genes. 20,687 of them contain coded instructions to construct proteins. The latest study show that human has about 19,000 genes.

The average size of a gene is 10–15 kb (kilo base-pairs). A small gene has about 0.2 bk (or 200 base pairs). A large gene has about 2,500 kb.

An example of a small gene is the SPRR4 (Small Proline Rich Protein 4) gene, which contains coded instructions to construct the SPRR4 protein. SPRR4 gene has 240 base pairs. If we separate the two DNA strands of this second of the double DNA helix structure, one strand is named as "sense strand" and the other as "antisense strand". The Nucleotide Sequence of the sense strand of the SPRR4 gene can be expressed as below using the 1-letter abbreviation of each Nucleotide:

ATGTCTTCCCAGCAGCAGCAGCGGCAGCAGCAGCAGTGCCCACCCCAGAGGGCCCAGCAGCAGCAAGTGA
AGCAGCCTTGTCAGCCACCCCCTGTTAAATGTCAAGAGACATGTGCACCCAAAACCAAGGATCCATGTGC
TCCCCAGGTCAAGAAGCAATGCCCACCGAAAGGCACCATCATTCCAGCCCAGCAGAAGTGTCCCTCAGCC
CAGCAAGCCTCCAAGAGCAAACAGAAGTAA

When a long DNA double helix wrapped and packaged into a chromosome, it may contain from 700 to 2,500 genes.

Table of Contents

 About This Book

 Introduction of Molecules

 Molecule Names and Identifications

 Molecule Mass and Weight

 Protein and Amino Acid

 Nucleobase, Nucleoside, Nucleotide, DNA and RNA

Gene and Chromosome

What Is Gene

 What Is Human Genome

 Gene Address on Chromosome

 DNA Coding and Codons

 Gene Expression - ­Building Proteins

 Genetic Transcription - Creating mRNA

 Genetic Translation - Creating Protein

 DNA Gene Sequence - Exons and Introns

 Chromosome Replication (or DNA Replication)

 Protein Kinase (PK)

 DNA Sequencing

 Gene Mutation

 SDF (Structure Data File)

 PyMol Installation

 PyMol GUI and CLI

 PyMol Selections

 PyMol Editing Functions

 PyMol Measurement Functions

 PyMol Movie Functions

 PyMol Python Integration

 PyMol Object Functions

 ChEMBL Database - European Molecular Biology Laboratory

 PubChem Database - National Library of Medicine

 PDB (Protein Data Bank)

 INSDC (International Nucleotide Sequence Database Collaboration)

 HGNC (HUGO Gene Nomenclature Committee)

 Relocated Tutorials

 Resources and Tools

 Molecule Related Terminologies

 References

 Full Version in PDF/EPUB